ID: 974487818

View in Genome Browser
Species Human (GRCh38)
Location 4:62526713-62526735
Sequence GAACCATGGAATCCAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974487816_974487818 -6 Left 974487816 4:62526696-62526718 CCGTGAGTCACGGAAGAGAACCA No data
Right 974487818 4:62526713-62526735 GAACCATGGAATCCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974487818 Original CRISPR GAACCATGGAATCCAGTGAC TGG Intergenic
No off target data available for this crispr