ID: 974508512

View in Genome Browser
Species Human (GRCh38)
Location 4:62807555-62807577
Sequence CAGGTCTCCATTGTTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974508512_974508519 25 Left 974508512 4:62807555-62807577 CCAGCTGTAACAATGGAGACCTG No data
Right 974508519 4:62807603-62807625 GCACTTCCCTTCCACAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974508512 Original CRISPR CAGGTCTCCATTGTTACAGC TGG (reversed) Intergenic
No off target data available for this crispr