ID: 974514876

View in Genome Browser
Species Human (GRCh38)
Location 4:62896822-62896844
Sequence TGCACCTCCCCCCATGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974514876_974514884 26 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514884 4:62896871-62896893 GGGAGGGAGGAGCCAAGAACAGG No data
974514876_974514883 13 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514883 4:62896858-62896880 ACTTTGTGGAGCTGGGAGGGAGG No data
974514876_974514882 10 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514882 4:62896855-62896877 CACACTTTGTGGAGCTGGGAGGG No data
974514876_974514878 -1 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514878 4:62896844-62896866 AGCTGGTGCTGCACACTTTGTGG No data
974514876_974514880 6 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514880 4:62896851-62896873 GCTGCACACTTTGTGGAGCTGGG No data
974514876_974514879 5 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG No data
974514876_974514881 9 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514881 4:62896854-62896876 GCACACTTTGTGGAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974514876 Original CRISPR TGCACCTCCCCCCATGCAGC TGG (reversed) Intergenic