ID: 974514879

View in Genome Browser
Species Human (GRCh38)
Location 4:62896850-62896872
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974514876_974514879 5 Left 974514876 4:62896822-62896844 CCAGCTGCATGGGGGGAGGTGCA No data
Right 974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type