ID: 974516577

View in Genome Browser
Species Human (GRCh38)
Location 4:62922026-62922048
Sequence GGAATACTAATGTATCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974516573_974516577 11 Left 974516573 4:62921992-62922014 CCAAATAATGTAAGATACATAAT No data
Right 974516577 4:62922026-62922048 GGAATACTAATGTATCTTCATGG No data
974516572_974516577 14 Left 974516572 4:62921989-62922011 CCACCAAATAATGTAAGATACAT No data
Right 974516577 4:62922026-62922048 GGAATACTAATGTATCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974516577 Original CRISPR GGAATACTAATGTATCTTCA TGG Intergenic
No off target data available for this crispr