ID: 974520876

View in Genome Browser
Species Human (GRCh38)
Location 4:62978425-62978447
Sequence GGGTTCAAACAGCTGGTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974520873_974520876 -4 Left 974520873 4:62978406-62978428 CCCTGTGTTTGTTAAGAATGGGT No data
Right 974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG No data
974520870_974520876 7 Left 974520870 4:62978395-62978417 CCTAACTTGTGCCCTGTGTTTGT No data
Right 974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG No data
974520869_974520876 22 Left 974520869 4:62978380-62978402 CCTTTTTTGGAATATCCTAACTT No data
Right 974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG No data
974520874_974520876 -5 Left 974520874 4:62978407-62978429 CCTGTGTTTGTTAAGAATGGGTT No data
Right 974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974520876 Original CRISPR GGGTTCAAACAGCTGGTACT AGG Intergenic
No off target data available for this crispr