ID: 974525906

View in Genome Browser
Species Human (GRCh38)
Location 4:63049881-63049903
Sequence AACCACAGCCTACCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974525906_974525908 -4 Left 974525906 4:63049881-63049903 CCACAGCAGGGTAGGCTGTGGTT No data
Right 974525908 4:63049900-63049922 GGTTAAATCATTTCTCCTGAGGG No data
974525906_974525907 -5 Left 974525906 4:63049881-63049903 CCACAGCAGGGTAGGCTGTGGTT No data
Right 974525907 4:63049899-63049921 TGGTTAAATCATTTCTCCTGAGG No data
974525906_974525910 28 Left 974525906 4:63049881-63049903 CCACAGCAGGGTAGGCTGTGGTT No data
Right 974525910 4:63049932-63049954 TTAAGAAGAACAGAGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974525906 Original CRISPR AACCACAGCCTACCCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr