ID: 974534941

View in Genome Browser
Species Human (GRCh38)
Location 4:63162733-63162755
Sequence GTATCCTGCTTTATTTCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974534936_974534941 24 Left 974534936 4:63162686-63162708 CCAACAGCATAAAACCACATTCA No data
Right 974534941 4:63162733-63162755 GTATCCTGCTTTATTTCAACAGG No data
974534939_974534941 10 Left 974534939 4:63162700-63162722 CCACATTCAAGGGTAATTTATCA No data
Right 974534941 4:63162733-63162755 GTATCCTGCTTTATTTCAACAGG No data
974534935_974534941 25 Left 974534935 4:63162685-63162707 CCCAACAGCATAAAACCACATTC No data
Right 974534941 4:63162733-63162755 GTATCCTGCTTTATTTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974534941 Original CRISPR GTATCCTGCTTTATTTCAAC AGG Intergenic
No off target data available for this crispr