ID: 974540657

View in Genome Browser
Species Human (GRCh38)
Location 4:63229698-63229720
Sequence CAGATATACTAGGGTATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974540657_974540665 20 Left 974540657 4:63229698-63229720 CCTTGGATACCCTAGTATATCTG No data
Right 974540665 4:63229741-63229763 TTTACTTGAATGACGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974540657 Original CRISPR CAGATATACTAGGGTATCCA AGG (reversed) Intergenic
No off target data available for this crispr