ID: 974549269

View in Genome Browser
Species Human (GRCh38)
Location 4:63349778-63349800
Sequence TGCGCCAGATGCAGCGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974549269_974549277 -2 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549277 4:63349799-63349821 CACAAGGCGCGTGGGCCCGGGGG No data
974549269_974549273 -10 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549273 4:63349791-63349813 ATCTGGCGCACAAGGCGCGTGGG No data
974549269_974549276 -3 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549276 4:63349798-63349820 GCACAAGGCGCGTGGGCCCGGGG No data
974549269_974549274 -5 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549274 4:63349796-63349818 GCGCACAAGGCGCGTGGGCCCGG No data
974549269_974549278 11 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549278 4:63349812-63349834 GGCCCGGGGGCCCTTTCAGCAGG No data
974549269_974549282 20 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549282 4:63349821-63349843 GCCCTTTCAGCAGGGAGCCGCGG No data
974549269_974549285 23 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549285 4:63349824-63349846 CTTTCAGCAGGGAGCCGCGGTGG No data
974549269_974549279 12 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549279 4:63349813-63349835 GCCCGGGGGCCCTTTCAGCAGGG No data
974549269_974549275 -4 Left 974549269 4:63349778-63349800 CCCTTGGCGCTGCATCTGGCGCA No data
Right 974549275 4:63349797-63349819 CGCACAAGGCGCGTGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974549269 Original CRISPR TGCGCCAGATGCAGCGCCAA GGG (reversed) Intergenic