ID: 974554948

View in Genome Browser
Species Human (GRCh38)
Location 4:63434307-63434329
Sequence ACTTGTATGCAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974554946_974554948 23 Left 974554946 4:63434261-63434283 CCGTATATGTGCTATAAAATAAA No data
Right 974554948 4:63434307-63434329 ACTTGTATGCAGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974554948 Original CRISPR ACTTGTATGCAGATGGAAGA TGG Intergenic
No off target data available for this crispr