ID: 974560902

View in Genome Browser
Species Human (GRCh38)
Location 4:63516314-63516336
Sequence TGGGCTTTTACCGGTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974560898_974560902 6 Left 974560898 4:63516285-63516307 CCATGTAGTGGTATAGTGTTATT No data
Right 974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG No data
974560897_974560902 7 Left 974560897 4:63516284-63516306 CCCATGTAGTGGTATAGTGTTAT No data
Right 974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974560902 Original CRISPR TGGGCTTTTACCGGTTTTCA AGG Intergenic
No off target data available for this crispr