ID: 974561489

View in Genome Browser
Species Human (GRCh38)
Location 4:63527900-63527922
Sequence TGTAATAATCCCTATGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974561488_974561489 29 Left 974561488 4:63527848-63527870 CCAACAAATGTATTTGGTAATAT No data
Right 974561489 4:63527900-63527922 TGTAATAATCCCTATGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974561489 Original CRISPR TGTAATAATCCCTATGAGTT AGG Intergenic
No off target data available for this crispr