ID: 974563443

View in Genome Browser
Species Human (GRCh38)
Location 4:63553002-63553024
Sequence CTCTGTTAGGGGATTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974563443_974563454 20 Left 974563443 4:63553002-63553024 CCTTCCACAATCCCCTAACAGAG No data
Right 974563454 4:63553045-63553067 CCCTGCAGCAAACTTCTGCCCGG 0: 721
1: 1546
2: 1624
3: 1286
4: 1036
974563443_974563456 21 Left 974563443 4:63553002-63553024 CCTTCCACAATCCCCTAACAGAG No data
Right 974563456 4:63553046-63553068 CCTGCAGCAAACTTCTGCCCGGG 0: 5
1: 318
2: 649
3: 546
4: 558
974563443_974563457 29 Left 974563443 4:63553002-63553024 CCTTCCACAATCCCCTAACAGAG No data
Right 974563457 4:63553054-63553076 AAACTTCTGCCCGGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974563443 Original CRISPR CTCTGTTAGGGGATTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr