ID: 974563735

View in Genome Browser
Species Human (GRCh38)
Location 4:63555767-63555789
Sequence GGTTGTGAGAAAATTATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974563735_974563739 13 Left 974563735 4:63555767-63555789 CCAGGAATAATTTTCTCACAACC No data
Right 974563739 4:63555803-63555825 CAGTGCTCAACATAAGCTGTTGG No data
974563735_974563740 20 Left 974563735 4:63555767-63555789 CCAGGAATAATTTTCTCACAACC No data
Right 974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974563735 Original CRISPR GGTTGTGAGAAAATTATTCC TGG (reversed) Intergenic
No off target data available for this crispr