ID: 974563737

View in Genome Browser
Species Human (GRCh38)
Location 4:63555795-63555817
Sequence TTATGTTGAGCACTGGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974563737_974563740 -8 Left 974563737 4:63555795-63555817 CCTCAGTCCAGTGCTCAACATAA No data
Right 974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974563737 Original CRISPR TTATGTTGAGCACTGGACTG AGG (reversed) Intergenic
No off target data available for this crispr