ID: 974563740

View in Genome Browser
Species Human (GRCh38)
Location 4:63555810-63555832
Sequence CAACATAAGCTGTTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974563735_974563740 20 Left 974563735 4:63555767-63555789 CCAGGAATAATTTTCTCACAACC No data
Right 974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG No data
974563736_974563740 -1 Left 974563736 4:63555788-63555810 CCTTCTACCTCAGTCCAGTGCTC No data
Right 974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG No data
974563737_974563740 -8 Left 974563737 4:63555795-63555817 CCTCAGTCCAGTGCTCAACATAA No data
Right 974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974563740 Original CRISPR CAACATAAGCTGTTGGAGCT TGG Intergenic
No off target data available for this crispr