ID: 974564786

View in Genome Browser
Species Human (GRCh38)
Location 4:63568283-63568305
Sequence AGTTATCTCCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974564786_974564791 21 Left 974564786 4:63568283-63568305 CCTGCCATCTTCTGGAGATAACT No data
Right 974564791 4:63568327-63568349 TGTTGCCTGTGCCTGGGCTTTGG No data
974564786_974564790 15 Left 974564786 4:63568283-63568305 CCTGCCATCTTCTGGAGATAACT No data
Right 974564790 4:63568321-63568343 GAGAGCTGTTGCCTGTGCCTGGG No data
974564786_974564789 14 Left 974564786 4:63568283-63568305 CCTGCCATCTTCTGGAGATAACT No data
Right 974564789 4:63568320-63568342 AGAGAGCTGTTGCCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974564786 Original CRISPR AGTTATCTCCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr