ID: 974564789

View in Genome Browser
Species Human (GRCh38)
Location 4:63568320-63568342
Sequence AGAGAGCTGTTGCCTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974564787_974564789 10 Left 974564787 4:63568287-63568309 CCATCTTCTGGAGATAACTACTC No data
Right 974564789 4:63568320-63568342 AGAGAGCTGTTGCCTGTGCCTGG No data
974564786_974564789 14 Left 974564786 4:63568283-63568305 CCTGCCATCTTCTGGAGATAACT No data
Right 974564789 4:63568320-63568342 AGAGAGCTGTTGCCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974564789 Original CRISPR AGAGAGCTGTTGCCTGTGCC TGG Intergenic
No off target data available for this crispr