ID: 974564790

View in Genome Browser
Species Human (GRCh38)
Location 4:63568321-63568343
Sequence GAGAGCTGTTGCCTGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974564786_974564790 15 Left 974564786 4:63568283-63568305 CCTGCCATCTTCTGGAGATAACT No data
Right 974564790 4:63568321-63568343 GAGAGCTGTTGCCTGTGCCTGGG No data
974564787_974564790 11 Left 974564787 4:63568287-63568309 CCATCTTCTGGAGATAACTACTC No data
Right 974564790 4:63568321-63568343 GAGAGCTGTTGCCTGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974564790 Original CRISPR GAGAGCTGTTGCCTGTGCCT GGG Intergenic
No off target data available for this crispr