ID: 974564791

View in Genome Browser
Species Human (GRCh38)
Location 4:63568327-63568349
Sequence TGTTGCCTGTGCCTGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974564787_974564791 17 Left 974564787 4:63568287-63568309 CCATCTTCTGGAGATAACTACTC No data
Right 974564791 4:63568327-63568349 TGTTGCCTGTGCCTGGGCTTTGG No data
974564788_974564791 -7 Left 974564788 4:63568311-63568333 CCTTTTGTGAGAGAGCTGTTGCC No data
Right 974564791 4:63568327-63568349 TGTTGCCTGTGCCTGGGCTTTGG No data
974564786_974564791 21 Left 974564786 4:63568283-63568305 CCTGCCATCTTCTGGAGATAACT No data
Right 974564791 4:63568327-63568349 TGTTGCCTGTGCCTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974564791 Original CRISPR TGTTGCCTGTGCCTGGGCTT TGG Intergenic
No off target data available for this crispr