ID: 974583405

View in Genome Browser
Species Human (GRCh38)
Location 4:63836829-63836851
Sequence ACATATAAGCTACAGTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974583403_974583405 3 Left 974583403 4:63836803-63836825 CCAGCCAGGAGGTGGCACTTTAA No data
Right 974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG No data
974583404_974583405 -1 Left 974583404 4:63836807-63836829 CCAGGAGGTGGCACTTTAAAGAA No data
Right 974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG No data
974583402_974583405 6 Left 974583402 4:63836800-63836822 CCTCCAGCCAGGAGGTGGCACTT 0: 106
1: 268
2: 395
3: 415
4: 556
Right 974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974583405 Original CRISPR ACATATAAGCTACAGTAGTA TGG Intergenic
No off target data available for this crispr