ID: 974589097

View in Genome Browser
Species Human (GRCh38)
Location 4:63920077-63920099
Sequence GTTTTTCACTGTAGCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974589094_974589097 12 Left 974589094 4:63920042-63920064 CCTGGAATGGGGGCTTCAGGACT No data
Right 974589097 4:63920077-63920099 GTTTTTCACTGTAGCTCAGCTGG No data
974589088_974589097 25 Left 974589088 4:63920029-63920051 CCAGGAGCTATGGCCTGGAATGG No data
Right 974589097 4:63920077-63920099 GTTTTTCACTGTAGCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974589097 Original CRISPR GTTTTTCACTGTAGCTCAGC TGG Intergenic
No off target data available for this crispr