ID: 974593659

View in Genome Browser
Species Human (GRCh38)
Location 4:63988510-63988532
Sequence GCTTGGTCTTGTCCTGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974593659_974593662 17 Left 974593659 4:63988510-63988532 CCAAAAGCAGGACAAGACCAAGC No data
Right 974593662 4:63988550-63988572 GTCTAATATTACCGATGGTATGG No data
974593659_974593661 12 Left 974593659 4:63988510-63988532 CCAAAAGCAGGACAAGACCAAGC No data
Right 974593661 4:63988545-63988567 CTGTAGTCTAATATTACCGATGG No data
974593659_974593663 27 Left 974593659 4:63988510-63988532 CCAAAAGCAGGACAAGACCAAGC No data
Right 974593663 4:63988560-63988582 ACCGATGGTATGGTTTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974593659 Original CRISPR GCTTGGTCTTGTCCTGCTTT TGG (reversed) Intergenic
No off target data available for this crispr