ID: 974595385

View in Genome Browser
Species Human (GRCh38)
Location 4:64008106-64008128
Sequence GTTTGTAAAGGGATCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974595385_974595397 13 Left 974595385 4:64008106-64008128 CCTTCCAGGATCCCTTTACAAAC No data
Right 974595397 4:64008142-64008164 TCCTCAGGGAGATGGATGTCAGG No data
974595385_974595391 -1 Left 974595385 4:64008106-64008128 CCTTCCAGGATCCCTTTACAAAC No data
Right 974595391 4:64008128-64008150 CCCCAGCCCAGAACTCCTCAGGG 0: 5
1: 23
2: 42
3: 97
4: 366
974595385_974595389 -2 Left 974595385 4:64008106-64008128 CCTTCCAGGATCCCTTTACAAAC No data
Right 974595389 4:64008127-64008149 ACCCCAGCCCAGAACTCCTCAGG No data
974595385_974595395 5 Left 974595385 4:64008106-64008128 CCTTCCAGGATCCCTTTACAAAC No data
Right 974595395 4:64008134-64008156 CCCAGAACTCCTCAGGGAGATGG 0: 6
1: 18
2: 42
3: 87
4: 388
974595385_974595399 14 Left 974595385 4:64008106-64008128 CCTTCCAGGATCCCTTTACAAAC No data
Right 974595399 4:64008143-64008165 CCTCAGGGAGATGGATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974595385 Original CRISPR GTTTGTAAAGGGATCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr