ID: 974600299

View in Genome Browser
Species Human (GRCh38)
Location 4:64071185-64071207
Sequence TTGTATTGGCTAACAATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974600299_974600309 8 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600309 4:64071216-64071238 ATGTCTCCGTAGAGGGGCTAGGG No data
974600299_974600306 1 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600306 4:64071209-64071231 GGGGGAAATGTCTCCGTAGAGGG No data
974600299_974600307 2 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600307 4:64071210-64071232 GGGGAAATGTCTCCGTAGAGGGG No data
974600299_974600312 23 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600312 4:64071231-64071253 GGCTAGGGGTCAGAATGATATGG No data
974600299_974600313 28 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600313 4:64071236-64071258 GGGGTCAGAATGATATGGTTTGG No data
974600299_974600310 9 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600310 4:64071217-64071239 TGTCTCCGTAGAGGGGCTAGGGG No data
974600299_974600305 0 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600305 4:64071208-64071230 TGGGGGAAATGTCTCCGTAGAGG No data
974600299_974600308 7 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600308 4:64071215-64071237 AATGTCTCCGTAGAGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974600299 Original CRISPR TTGTATTGGCTAACAATATT TGG (reversed) Intergenic
No off target data available for this crispr