ID: 974600304

View in Genome Browser
Species Human (GRCh38)
Location 4:64071199-64071221
Sequence AGACATTTCCCCCATTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974600304_974600310 -5 Left 974600304 4:64071199-64071221 CCAATACAATGGGGGAAATGTCT No data
Right 974600310 4:64071217-64071239 TGTCTCCGTAGAGGGGCTAGGGG No data
974600304_974600309 -6 Left 974600304 4:64071199-64071221 CCAATACAATGGGGGAAATGTCT No data
Right 974600309 4:64071216-64071238 ATGTCTCCGTAGAGGGGCTAGGG No data
974600304_974600312 9 Left 974600304 4:64071199-64071221 CCAATACAATGGGGGAAATGTCT No data
Right 974600312 4:64071231-64071253 GGCTAGGGGTCAGAATGATATGG No data
974600304_974600308 -7 Left 974600304 4:64071199-64071221 CCAATACAATGGGGGAAATGTCT No data
Right 974600308 4:64071215-64071237 AATGTCTCCGTAGAGGGGCTAGG No data
974600304_974600313 14 Left 974600304 4:64071199-64071221 CCAATACAATGGGGGAAATGTCT No data
Right 974600313 4:64071236-64071258 GGGGTCAGAATGATATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974600304 Original CRISPR AGACATTTCCCCCATTGTAT TGG (reversed) Intergenic
No off target data available for this crispr