ID: 974600309

View in Genome Browser
Species Human (GRCh38)
Location 4:64071216-64071238
Sequence ATGTCTCCGTAGAGGGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974600304_974600309 -6 Left 974600304 4:64071199-64071221 CCAATACAATGGGGGAAATGTCT No data
Right 974600309 4:64071216-64071238 ATGTCTCCGTAGAGGGGCTAGGG No data
974600299_974600309 8 Left 974600299 4:64071185-64071207 CCAAATATTGTTAGCCAATACAA No data
Right 974600309 4:64071216-64071238 ATGTCTCCGTAGAGGGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974600309 Original CRISPR ATGTCTCCGTAGAGGGGCTA GGG Intergenic
No off target data available for this crispr