ID: 974603709

View in Genome Browser
Species Human (GRCh38)
Location 4:64122398-64122420
Sequence CTTCTCTGTGTACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974603705_974603709 2 Left 974603705 4:64122373-64122395 CCCTGGTGGATCCAGGTTTGTGT No data
Right 974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG No data
974603706_974603709 1 Left 974603706 4:64122374-64122396 CCTGGTGGATCCAGGTTTGTGTA No data
Right 974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG No data
974603707_974603709 -9 Left 974603707 4:64122384-64122406 CCAGGTTTGTGTACCTTCTCTGT No data
Right 974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974603709 Original CRISPR CTTCTCTGTGTACCACAAGC AGG Intergenic
No off target data available for this crispr