ID: 974614468

View in Genome Browser
Species Human (GRCh38)
Location 4:64264484-64264506
Sequence GAACTACCAATGCTGTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974614468_974614475 30 Left 974614468 4:64264484-64264506 CCAAGCTACAGCATTGGTAGTTC No data
Right 974614475 4:64264537-64264559 AGCCAGTTTTGAGCTTGCAAAGG No data
974614468_974614470 -3 Left 974614468 4:64264484-64264506 CCAAGCTACAGCATTGGTAGTTC No data
Right 974614470 4:64264504-64264526 TTCCCATTGCTCTTCCTAGGAGG No data
974614468_974614469 -6 Left 974614468 4:64264484-64264506 CCAAGCTACAGCATTGGTAGTTC No data
Right 974614469 4:64264501-64264523 TAGTTCCCATTGCTCTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974614468 Original CRISPR GAACTACCAATGCTGTAGCT TGG (reversed) Intergenic
No off target data available for this crispr