ID: 974615638

View in Genome Browser
Species Human (GRCh38)
Location 4:64276339-64276361
Sequence GTGTTAACTCTGAGAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974615638 Original CRISPR GTGTTAACTCTGAGAGAACA TGG Intronic
900004793 1:37787-37809 GTGTGAACACTGGGAGTACAAGG - Intergenic
902145045 1:14391634-14391656 GTGTTAACTGTGAACTAACAGGG - Intergenic
908432632 1:64073798-64073820 GTGTTAACCCTTCGGGAACAGGG - Intronic
910244544 1:85124473-85124495 CTGTTAAGTTTCAGAGAACAAGG - Intronic
911682572 1:100734304-100734326 GTTTTAACTAAGAGAGTACATGG - Intronic
911847036 1:102766869-102766891 GTTTTAACTTTCAGAGAAAAGGG + Intergenic
912626588 1:111209897-111209919 ATGCAAACTCTGTGAGAACAAGG - Intronic
913679774 1:121178716-121178738 CTGTTAGCTCTGTGAGAACAAGG - Intronic
916798471 1:168190281-168190303 GTGTTATCTCTAAGTGACCATGG + Intronic
918533528 1:185549247-185549269 TTGTAAACTCTGGGAGAAAAGGG + Intergenic
920467084 1:206197252-206197274 CTGTTAGCTCCGTGAGAACAAGG - Intronic
920929836 1:210376897-210376919 GTGTGATCTCAGAGAGAAAAAGG - Intronic
921290633 1:213653674-213653696 TTGTAAACTCTGAAAGGACAGGG + Intergenic
922607273 1:226897454-226897476 GTGTTAAGACTGAGAAAACAAGG + Intergenic
923003794 1:230029033-230029055 AAGTTGACTCTGAGAAAACAAGG - Intergenic
1063144323 10:3283159-3283181 GGGTTAACTCTTTGAGAACAAGG - Intergenic
1064556577 10:16552547-16552569 GTGTTACCTCTGTGAGAAACAGG - Intergenic
1065494035 10:26311049-26311071 GTGTTAATTCTGAAAGACAAGGG + Intergenic
1065752528 10:28900191-28900213 GTGTAACTTCTGAGATAACATGG + Intergenic
1066340181 10:34524850-34524872 GTGTTCCCTCAAAGAGAACATGG + Intronic
1066797799 10:39143419-39143441 GTTTTAACTCTGTGAGATGAAGG - Intergenic
1066804505 10:39232137-39232159 GTTTTAACTCTGTGAGATTAAGG - Intergenic
1068357222 10:55924132-55924154 GTCTCAACTCTGAAAGAAAAGGG - Intergenic
1068407468 10:56609097-56609119 GTTTTAAATCTGAGAAACCAAGG - Intergenic
1069583922 10:69584396-69584418 GTATTTACTCTGAGAGAAACAGG + Intergenic
1070051637 10:72895471-72895493 GTGTTTGCCCTGAGAGGACAGGG + Intronic
1070507874 10:77131446-77131468 GGCGTAACACTGAGAGAACAAGG + Intronic
1073152129 10:101319279-101319301 TTGTGAACTCTGTAAGAACAGGG + Intergenic
1074339145 10:112609444-112609466 GTGTAAACTCTGTGACGACAGGG + Intronic
1074348323 10:112710052-112710074 GGGTTAACTCCTGGAGAACAAGG + Intronic
1075851617 10:125592925-125592947 GTGTTGCCCCTGAGAGGACATGG - Intronic
1078098905 11:8317755-8317777 GTGTAAACTCCATGAGAACAGGG - Intergenic
1079855672 11:25600724-25600746 GTCTTAACTCTGAAAACACAGGG - Intergenic
1080832607 11:35910085-35910107 TGGTTAACTCTGAGATAACCTGG - Intergenic
1081192352 11:40119489-40119511 CTGTGGACTCTGTGAGAACAGGG + Intronic
1081227799 11:40546219-40546241 GTGTGATCTCTGTTAGAACAGGG - Intronic
1082303759 11:50545331-50545353 GATTTAACTCTGAGAGATCAAGG + Intergenic
1082980302 11:59114750-59114772 GTGTCAGCTCCAAGAGAACAAGG - Intronic
1085208770 11:74754905-74754927 ATGTTAACCCTAAGTGAACAGGG - Intronic
1085584268 11:77686441-77686463 GGATTAACTTTGAGAGAACCAGG - Intronic
1086578073 11:88363181-88363203 GTGTTTGCTCTGTGAGACCAGGG - Intergenic
1086649994 11:89276812-89276834 GTGTAAACACACAGAGAACAGGG + Intronic
1087964110 11:104391437-104391459 GAGTTGAATCTGAGAGAACAAGG - Intergenic
1088090538 11:106033922-106033944 GAGTAAACTCTGTAAGAACAGGG - Intergenic
1088753452 11:112865449-112865471 GAATAAGCTCTGAGAGAACAAGG - Intergenic
1091378203 12:39838-39860 GTGTGAACACTGGGAGTACAAGG - Intergenic
1092847668 12:12599047-12599069 GTGACAAATCTGAGAGAACTTGG - Intergenic
1093489803 12:19692398-19692420 GTCTTGACTCTGGGAGAAGAGGG - Intronic
1095076808 12:37939583-37939605 GTTTTAACTCTGTGAGATGAAGG + Intergenic
1103427213 12:120846147-120846169 GGGTTAGCTCTGTGAGAGCAGGG + Intronic
1105392817 13:19996801-19996823 GTTTTAAGTCTGGGAGATCAAGG + Intronic
1106987688 13:35373931-35373953 GAGTTAACTCTGGAATAACATGG - Intronic
1110302111 13:73940722-73940744 GTGTAAACTCCTAGAGGACAAGG - Intronic
1110856200 13:80299427-80299449 CTGTTATCTCTGAGGAAACAAGG - Intergenic
1113017902 13:105849084-105849106 GTGGTAACTCTGACAGAACGTGG - Intergenic
1118107446 14:62676120-62676142 GTGTGAACGGAGAGAGAACAAGG - Intergenic
1118270979 14:64341955-64341977 GTGTTAACTCTGAGCAAACAGGG - Intergenic
1118967764 14:70603763-70603785 CTGTAAACTCTGTGAGGACATGG + Intergenic
1119775548 14:77246060-77246082 GTCTTAACTCTAAGAGAGCCTGG - Intronic
1121630782 14:95420449-95420471 GTGTTAACTCTGAGAATGAAGGG - Intronic
1122470128 14:101960853-101960875 GTGATAACCCTGAGAGGAGATGG + Intergenic
1125660612 15:41391919-41391941 TTGTTAAATCTGACAGAAAAGGG + Intronic
1132081392 15:98868943-98868965 GTGTTACCTGTGAGAGAGCTGGG + Intronic
1132448717 15:101953157-101953179 GTGTGAACACTGGGAGTACAAGG + Intergenic
1133571918 16:7049492-7049514 GTCTTAACACTAAGAGAATAGGG - Intronic
1138838171 16:60463670-60463692 GTGATAACACTCAGAGAACAGGG - Intergenic
1139350757 16:66333838-66333860 CTCTGAACTGTGAGAGAACAGGG + Intergenic
1142330372 16:89448402-89448424 GTGTGAATTCTGACAGATCAGGG - Intronic
1143057951 17:4176414-4176436 GTGTTTGAGCTGAGAGAACAAGG - Intronic
1143225184 17:5295578-5295600 ATGTAAACTTTGACAGAACAGGG - Intronic
1143389250 17:6550497-6550519 GTGTGAACTTTCAGAGACCATGG - Intronic
1145070130 17:19798296-19798318 GTGTTATCTTTGTGAGAATATGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148001886 17:44393229-44393251 TTGTAATCTCTGAGAGAACAGGG - Intergenic
1148521661 17:48282424-48282446 ATGTTAGCTTTGAGGGAACAGGG - Intronic
1148693852 17:49547714-49547736 GTGTGAACTAGGAGAGGACAGGG + Intergenic
1148792352 17:50180481-50180503 GTGTGAACTGTGAGAACACATGG - Intergenic
1149820927 17:59776519-59776541 GTGTTAACTCTGAGGGAGTTTGG + Intronic
1151172389 17:72258018-72258040 GTGTCCACTGTGAGAGATCAAGG - Intergenic
1152700031 17:81814121-81814143 GTGCCAACTCTGAGTGAACTGGG - Intergenic
1155466335 18:26139731-26139753 GACTAAACTCTGAGAGAAGAGGG + Intronic
1155794635 18:30020908-30020930 GTGTAAGATCTGAAAGAACAAGG + Intergenic
1158226870 18:55210534-55210556 CTATTAGCTCTGTGAGAACATGG - Intergenic
1158833740 18:61308235-61308257 GTGTTCTCTCTCAGAGCACAAGG - Intergenic
1158980338 18:62754511-62754533 CAGTTAACGCTGAGAGAGCAAGG + Intronic
1160636545 19:79396-79418 GTGTGAACACTGGGAGTACAAGG - Intergenic
1164336842 19:24332092-24332114 GGGTTAACTCTGTGAGATGAAGG - Intergenic
1164337498 19:24343357-24343379 GGTTTAACTCTGTGAGAAGAAGG - Intergenic
1164359709 19:27491214-27491236 GGTTTAACTCTGAGAGATGAAGG - Intergenic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1165389859 19:35532509-35532531 CTGTAAGCTCTGAGAGGACAGGG - Intergenic
1166423301 19:42654713-42654735 GTGTGAGCTCTGTGAGGACAGGG - Intronic
1166708595 19:44922919-44922941 GGGTTTACTCTGAGAGAATCAGG - Intergenic
1167252496 19:48407699-48407721 TTGTAAGCTCTGAGAGAGCAGGG - Intronic
1167684547 19:50948511-50948533 GTATGAGCTCTGTGAGAACAGGG + Intronic
925253207 2:2459969-2459991 GGCTGAACTCGGAGAGAACAGGG + Intergenic
925802879 2:7618709-7618731 GTGTGAACTCTGATGGGACATGG + Intergenic
925811359 2:7703918-7703940 GTGTTAACTCTTTGAGGAAATGG - Intergenic
927843756 2:26461045-26461067 GTGTCAGCTCAGAGTGAACAGGG + Intronic
929888438 2:45899203-45899225 ATGTGACCTCTGAGAGAATAAGG - Intronic
930982998 2:57550719-57550741 GTGCTAGTTCTGGGAGAACATGG - Intergenic
933352573 2:81173572-81173594 GTGTTATCCCTGAAAGATCACGG + Intergenic
933983842 2:87574697-87574719 GTGTTGGCTCTGAGGAAACAGGG + Intergenic
934495720 2:94795653-94795675 GTGTTAACACAGAAAGAAAATGG - Intergenic
935867579 2:107407601-107407623 CTGTCACCTCTGAGATAACAAGG + Intergenic
936262251 2:110971389-110971411 GTGTTACCGCTGGGAGAAAATGG + Intronic
936310012 2:111376097-111376119 GTGTTGGCTCTGAGGAAACAGGG - Intergenic
936564936 2:113575644-113575666 GTGTGAACACTGGGAGTACAAGG + Intergenic
939103537 2:137923923-137923945 TTGTTAAATCTCAGAGAACGGGG - Intergenic
940291364 2:152080439-152080461 GTGTCAACTCTATGAGAACATGG + Intronic
942003525 2:171675053-171675075 CAGTTAACTCTCTGAGAACAGGG - Intergenic
942990092 2:182190256-182190278 GTCATAACTCAGAGAAAACAAGG + Intronic
943515508 2:188881022-188881044 CTGTTAACTCTGAGGGATGAGGG + Intergenic
945609545 2:211982436-211982458 GTGTTAAAGCTCTGAGAACAAGG + Intronic
948637256 2:239347311-239347333 GTGTTAACCCTGTGAGTCCAGGG - Intronic
948704403 2:239779983-239780005 GTGCTAACTCTGAGAGAGGAGGG - Intronic
1170509297 20:17060231-17060253 GTATTAACTCTGAGAGGGTAGGG - Intergenic
1170528481 20:17265371-17265393 TTGTTAACTCTAAGAGGATAAGG + Intronic
1170735854 20:19013639-19013661 GTGCTAGCTCTGAGAATACAGGG + Intergenic
1171162792 20:22943393-22943415 GTGTTAACTTTTGGAGAACTGGG + Intergenic
1177600583 21:23306344-23306366 GTGCTAACTATGAGGGAAAATGG - Intergenic
1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG + Intergenic
1178281142 21:31284120-31284142 GTGTTCCCTGTGAGAGAACTAGG + Intronic
1178553724 21:33567511-33567533 TTGTAAACTCTGTGAGGACAGGG - Intronic
1180946765 22:19698972-19698994 GTGTTAAATCTAACAAAACATGG - Intergenic
1182806063 22:33071615-33071637 CTGTTAACTGTGTGAGAACAGGG - Intergenic
1183667832 22:39255430-39255452 CTGTCAACTCTGAGAGGGCAGGG - Intergenic
1184218000 22:43079978-43080000 GTGTTAACTTTTAGGGAAGAAGG - Exonic
949267393 3:2174475-2174497 GTGAGAACTCAGAGAGAAGAAGG - Intronic
949286787 3:2416080-2416102 TTGTTCACTCTGTGAGAACATGG - Intronic
949545288 3:5067229-5067251 GTGTTGACACTGACAGAAAAAGG - Intergenic
951279838 3:20734701-20734723 GCATTTACTCTGAGTGAACAAGG + Intergenic
952409871 3:33038332-33038354 GTGTTAACCTTCAGAGCACAGGG - Intronic
954899593 3:54007416-54007438 GTGTTTACTCTGGGAGAACTTGG - Intergenic
955794233 3:62618898-62618920 CTGTTAGCTCTGTGAGAGCAGGG - Intronic
957644649 3:82905499-82905521 GTTTCAACTCTGACAGAGCATGG + Intergenic
960392950 3:117101866-117101888 GTGTTGGCTCTGCTAGAACATGG + Intronic
961371860 3:126436129-126436151 GAGTTAACTCTGAAATAACTGGG - Intronic
963767792 3:149355678-149355700 GTGTTCACTCTGAGAGGCCGAGG - Intergenic
964731825 3:159875699-159875721 GTGTTAAACCTTAGATAACATGG - Intronic
966478834 3:180382207-180382229 GTTTTTGCTCTGAGATAACAGGG + Intergenic
967162832 3:186754365-186754387 ATGTTAACAGTGAGGGAACATGG + Intergenic
970373906 4:15436750-15436772 GTGTTAACTCTAAAAGAGGAAGG + Intronic
972443565 4:39120586-39120608 GTGCTACCTCTGAGATAGCATGG + Intronic
973022120 4:45216841-45216863 GTCTTAACTCTCAGGGGACACGG - Intergenic
974615638 4:64276339-64276361 GTGTTAACTCTGAGAGAACATGG + Intronic
975326148 4:73060962-73060984 GTGTTAGCTCTGAGTAAACATGG + Intronic
978474690 4:109112825-109112847 GTTTTACCTCTGAGAGATCTGGG - Intronic
978716819 4:111854657-111854679 CTGTTAAGCCTGAGAGAATATGG + Intergenic
980546591 4:134271336-134271358 TTGTTATGTCTCAGAGAACAGGG - Intergenic
981650019 4:147046767-147046789 CTGGTAAATTTGAGAGAACAAGG - Intergenic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
983356589 4:166667789-166667811 GTCTTAACTCTTTGAGACCATGG - Intergenic
983469313 4:168136959-168136981 GTGTTAAGTCTGTGAGTGCATGG - Intronic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
985375231 4:189329489-189329511 GTCTTAAATCTGAGAGAGGAAGG - Intergenic
988238021 5:28572158-28572180 TTGTTGACTGTGAGACAACATGG - Intergenic
989837658 5:46013254-46013276 GGTTTAACTCTGTGAGAAGAAGG - Intergenic
990321474 5:54633810-54633832 GTGTTGACTCTAAAAGAACATGG - Intergenic
991263771 5:64692954-64692976 GTATTAACTCTCAGAAAAGATGG - Intronic
991962823 5:72062796-72062818 GTTTTTACTCTGAGAGAAACGGG + Intergenic
992386579 5:76290410-76290432 TTGATAAATCTGAGAGGACATGG - Intronic
992829886 5:80583960-80583982 ATGTTAACTCTTAAACAACAAGG - Intergenic
993757990 5:91755646-91755668 TTGTTATTTGTGAGAGAACATGG + Intergenic
994046841 5:95319885-95319907 GTGTCATTTCTGAGAGAGCAGGG - Intergenic
994071930 5:95612598-95612620 GTGAGACCTCTGACAGAACACGG + Intergenic
994283176 5:97930803-97930825 CTGCTAACTCTGAAAGCACATGG - Intergenic
995594986 5:113738461-113738483 TTCTTAAATCTGAGAAAACATGG - Intergenic
996108697 5:119538915-119538937 ATGTTAGCTCTGTGAGAACAGGG + Intronic
998824630 5:146088443-146088465 GTGCTCACTGTGGGAGAACAAGG - Intronic
998840768 5:146251114-146251136 TTGTTATCTCTGTGAGCACATGG - Intronic
1000828096 5:166071016-166071038 GAGTTTATTCTGAAAGAACAAGG + Intergenic
1004303288 6:14477589-14477611 GTGGTAACTCTCAGGGGACATGG - Intergenic
1004922160 6:20385866-20385888 GTGTTAACTCTCAACTAACAAGG + Intergenic
1005008958 6:21317665-21317687 TTATTAACTGTGAGAAAACAAGG + Intergenic
1006077534 6:31543520-31543542 ATGTAAACACTGTGAGAACAGGG - Intronic
1009262889 6:61517919-61517941 GGATTAACTCTGAGAGATGAAGG - Intergenic
1009597970 6:65760782-65760804 CTGTTAACTGAGAGAGAAGAAGG - Intergenic
1010092335 6:71998488-71998510 ATGTAAACTCCAAGAGAACAGGG + Intronic
1010131319 6:72497120-72497142 GTGTGAACTTAGAGATAACAAGG - Intergenic
1010304346 6:74301474-74301496 ATGGTAACTCTGTGAGAAGATGG + Intergenic
1013879189 6:114874065-114874087 GTGTTAGATCTGAGAAAATAGGG + Intergenic
1013917182 6:115354817-115354839 GTGTTAACTAGGAAAGAAAAAGG - Intergenic
1017449599 6:154542140-154542162 GTGTAGACTCTGTGAGAACCAGG - Intergenic
1019162790 6:170080408-170080430 GTGCTTACTCTGAGGAAACAGGG - Intergenic
1024895263 7:54252742-54252764 ATGTGAACTGTCAGAGAACATGG - Intergenic
1025572714 7:62596820-62596842 GTTTCAACTCTGAGAGATGAAGG + Intergenic
1025584562 7:62766826-62766848 GTTTTAACTCTGTGAGATGACGG + Intergenic
1025588903 7:62830057-62830079 GTTTTAACTCTGAGAGATGAAGG - Intergenic
1025591790 7:62869776-62869798 GTTTTAACTCTGTGAGATGATGG - Intergenic
1025596054 7:62927425-62927447 ATTTTAACTTTGAGAGATCAAGG - Intergenic
1025726657 7:64068714-64068736 TTTTTAACTCTGAGAAAAAATGG - Intronic
1025755605 7:64336082-64336104 TTTTTAACTCTGAGAAAAGATGG - Intronic
1026361496 7:69605002-69605024 CTTTTAATTCTGACAGAACATGG - Intronic
1029949833 7:104571974-104571996 TGGTTAACTCTGGGAGAAAAGGG - Intronic
1033145528 7:138867679-138867701 CTGTGAAGTCTGAGAGAACGGGG + Intronic
1033925736 7:146458092-146458114 GAGTTAACGCTGAGAACACATGG + Intronic
1036919889 8:12842154-12842176 GAGTAAACTCTGTGAGATCAGGG + Intergenic
1038147467 8:24912715-24912737 GTATTTACTCGGAGAGAAGAGGG + Intergenic
1039161696 8:34628674-34628696 TTGTTAAGTCTTAGAGAACCTGG + Intergenic
1040424598 8:47272992-47273014 GTGTTAAGCATGAGAGAAGAGGG - Intronic
1040680488 8:49802529-49802551 GTGTTAACTCTGATTAAAGAAGG - Intergenic
1042297228 8:67234230-67234252 TTATTAACTCTGTGAGGACAGGG - Intronic
1044907098 8:97016792-97016814 GTCAAAACTCTGAGATAACATGG + Intronic
1045827267 8:106413327-106413349 TCGTTAATTCTGAGAGTACATGG - Intronic
1045901962 8:107292500-107292522 AAATTAACTCTGAGAAAACAGGG - Intronic
1049887487 9:37569-37591 GTGTGAACACTGGGAGTACAAGG - Intergenic
1050267996 9:3911233-3911255 CTGTAAACTCTGTGAGAGCAGGG - Intronic
1051085018 9:13338404-13338426 TTGTTATGTCTGAGAGAATAGGG + Intergenic
1052443604 9:28530475-28530497 ATGTTTACTCTGAGAGGAAATGG - Intronic
1055932336 9:81572535-81572557 GTTTTAACTTTTAGACAACATGG - Intergenic
1059107539 9:111524619-111524641 GTTTTAACTCTGAGTGAAATGGG + Intergenic
1061670753 9:132186904-132186926 GTGTGAACTCTGGGAGAGCAGGG - Intronic
1203356016 Un_KI270442v1:145674-145696 GGGTTAACTCTGTGAGATTAAGG + Intergenic
1188310780 X:28613859-28613881 ATTTTAACTCTGAGAGAACATGG + Intronic
1190553402 X:51608919-51608941 GTGTGAACTCCCAGAGGACAGGG + Intergenic
1194093274 X:89603747-89603769 GTGTTAAGTCTGTGGGCACAAGG + Intergenic
1194767867 X:97863549-97863571 ATGTTAACTCTCTGAGGACACGG - Intergenic
1194810752 X:98384175-98384197 CTGTAAACTCTGTAAGAACAAGG + Intergenic
1195289778 X:103420833-103420855 GTGTTAAGTCTGTGGGCACATGG - Intergenic
1196992170 X:121342010-121342032 ATGTAAACTCTGGGAGATCAAGG - Intergenic
1198032595 X:132767983-132768005 GTATCAACTCTGAGAGACCCTGG - Intronic
1198372078 X:135999893-135999915 GTGTTAACTCTGATAACACAGGG + Intronic
1199907853 X:152252905-152252927 GTGTCAGCTCTGAGAGAGGATGG - Intronic
1200445906 Y:3259850-3259872 GTGTTAAGTCTGTGGGCACAAGG + Intergenic