ID: 974622705

View in Genome Browser
Species Human (GRCh38)
Location 4:64381877-64381899
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974622701_974622705 12 Left 974622701 4:64381842-64381864 CCTGTAGTACTATTTGCGTGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr