ID: 974625742

View in Genome Browser
Species Human (GRCh38)
Location 4:64427381-64427403
Sequence CAGTTACAGGAGGCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974625742_974625750 9 Left 974625742 4:64427381-64427403 CCCACCTCGGCCTCCTGTAACTG No data
Right 974625750 4:64427413-64427435 GCACTCACCACCACCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974625742 Original CRISPR CAGTTACAGGAGGCCGAGGT GGG (reversed) Intergenic
No off target data available for this crispr