ID: 974630031

View in Genome Browser
Species Human (GRCh38)
Location 4:64477620-64477642
Sequence CATCATGAACTAGAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974630031_974630034 10 Left 974630031 4:64477620-64477642 CCATCCAACTCTAGTTCATGATG No data
Right 974630034 4:64477653-64477675 AGTTAGAGTTCCTCTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974630031 Original CRISPR CATCATGAACTAGAGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr