ID: 974631103

View in Genome Browser
Species Human (GRCh38)
Location 4:64490117-64490139
Sequence ATGAATATGAAGAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974631103_974631107 18 Left 974631103 4:64490117-64490139 CCATTGTCCCTCTTCATATTCAT No data
Right 974631107 4:64490158-64490180 TGAGATATACAAACTAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974631103 Original CRISPR ATGAATATGAAGAGGGACAA TGG (reversed) Intergenic
No off target data available for this crispr