ID: 974632740

View in Genome Browser
Species Human (GRCh38)
Location 4:64515315-64515337
Sequence CTTATCTAAGAGAGTAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974632740_974632743 -3 Left 974632740 4:64515315-64515337 CCACCTTTACTCTCTTAGATAAG No data
Right 974632743 4:64515335-64515357 AAGAAAGAACAATTTGTAGGAGG No data
974632740_974632742 -6 Left 974632740 4:64515315-64515337 CCACCTTTACTCTCTTAGATAAG No data
Right 974632742 4:64515332-64515354 GATAAGAAAGAACAATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974632740 Original CRISPR CTTATCTAAGAGAGTAAAGG TGG (reversed) Intergenic
No off target data available for this crispr