ID: 974636121

View in Genome Browser
Species Human (GRCh38)
Location 4:64565754-64565776
Sequence CTGCTATGATTCTGAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974636116_974636121 11 Left 974636116 4:64565720-64565742 CCTATGATGACATTACAGCCAGG No data
Right 974636121 4:64565754-64565776 CTGCTATGATTCTGAAAAAATGG No data
974636118_974636121 -7 Left 974636118 4:64565738-64565760 CCAGGATTGCCTTCTCCTGCTAT 0: 68
1: 65
2: 22
3: 23
4: 247
Right 974636121 4:64565754-64565776 CTGCTATGATTCTGAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974636121 Original CRISPR CTGCTATGATTCTGAAAAAA TGG Intergenic
No off target data available for this crispr