ID: 974637921

View in Genome Browser
Species Human (GRCh38)
Location 4:64589675-64589697
Sequence CAGAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 2, 1: 40, 2: 79, 3: 87, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974637918_974637921 4 Left 974637918 4:64589648-64589670 CCTGGAGACTTGTTGAATGGTTG No data
Right 974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG 0: 2
1: 40
2: 79
3: 87
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974637921 Original CRISPR CAGAATGCTGATAGTGATAT GGG Intergenic
900395995 1:2453484-2453506 CGGAATGCTGACAGTGATCTGGG + Intronic
901132001 1:6967750-6967772 CTGAAGGCTGAGAGTGATATTGG + Intronic
901350077 1:8587507-8587529 CAGAATGCTGTTAGAGTTAGTGG - Intronic
905002094 1:34680576-34680598 CTGTTTGCTGATAGTGATATGGG + Intergenic
906205964 1:43986593-43986615 CTGAAGGCTGATAGTGACAGTGG + Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907422034 1:54354099-54354121 CAGGTTGCAGATAGTGAAATGGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909542475 1:76806429-76806451 CAGAATGTTGGTAGAGATATAGG + Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
910006664 1:82405426-82405448 CAGAAAGGTGATAGGAATATGGG - Intergenic
911064776 1:93778480-93778502 CAGATTGCTGGTAATAATATTGG - Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912575474 1:110667390-110667412 CAGTATGGTGATAGTGATTGGGG - Intergenic
915787576 1:158632656-158632678 CAGAATGCTAGCAGGGATATAGG + Intronic
916236084 1:162590372-162590394 AAGAATGCTGATAGTCAGAATGG + Exonic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917728704 1:177852902-177852924 GAGAATGCTGGCAGTGTTATTGG - Intergenic
918200565 1:182262429-182262451 TTGAAGGCTGATAGTGATAAGGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921325684 1:213984707-213984729 CAGGGTGCTGATAGTGATGGTGG + Intronic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067181952 10:43994695-43994717 GATAATGGTGATGGTGATATTGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072488650 10:95881110-95881132 CTGATAGCTGATAGTGATACAGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074918154 10:117979165-117979187 CAGAATGTTGATAGTGGGGTAGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079277684 11:19056885-19056907 CAGAATGGAGATTGTGATTTAGG + Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079570519 11:21937595-21937617 CAGAATGCTGCTGGGTATATAGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081844058 11:46225639-46225661 TAGAAAGCTGCTAGTGATAGGGG - Intergenic
1081960800 11:47135445-47135467 CAGAACACTGATAGGCATATGGG - Intronic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1086938641 11:92771251-92771273 CGGAATGCTGCTAGTGAAAATGG + Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092504073 12:9077367-9077389 CAGAAGGGCGATGGTGATATAGG + Exonic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095254991 12:40024088-40024110 CAGAATCCTGATAGAGACATAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099348119 12:81528268-81528290 AAGAACTCAGATAGTGATATGGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099929350 12:89055688-89055710 CATAACGCTGATTGTGACATGGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101819802 12:108175012-108175034 CAGAGTGCTGATGGTGGTCTTGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107691403 13:42957144-42957166 AAGCATGATGATAGGGATATGGG + Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110904391 13:80867214-80867236 CAGATTGTGGATAGTGATCTAGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111703986 13:91725117-91725139 CAGAATGGTGGAAGTGATATGGG + Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1118986431 14:70759595-70759617 CAGAAGCCTGAAAGTGATGTGGG - Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121651815 14:95564376-95564398 CAGAGTGATGATGGTGTTATTGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1123984606 15:25634057-25634079 GAGAATGATGACAGTGATAAAGG + Intergenic
1126360306 15:47838751-47838773 CAGAATGTTGACAGTCATAGAGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127718851 15:61680060-61680082 CAGATTGCTGATATTCATAGAGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131707891 15:95018177-95018199 CAGAATGCTGATCTTGCTAATGG - Intergenic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1138876975 16:60963991-60964013 TAGAATGCTGTTAGTGCTACTGG + Intergenic
1138918781 16:61501169-61501191 CAGAACTCTGAAAGTGGTATAGG + Intergenic
1138919939 16:61515192-61515214 TATAATTCTTATAGTGATATAGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1142976027 17:3645016-3645038 CAGGATGCTGAAAGTGATGCTGG - Intronic
1144160420 17:12552318-12552340 GATAATCGTGATAGTGATATTGG - Intergenic
1144588524 17:16503923-16503945 CAGGATGCAGATATTGACATGGG - Intergenic
1144647421 17:16984912-16984934 CAGACTGCAGATAGGGATTTGGG - Intergenic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1147839782 17:43363049-43363071 CAGAATACGGATACTGATGTGGG + Intergenic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1153328618 18:3848751-3848773 TAGGATGGTGACAGTGATATTGG - Intronic
1153777832 18:8469265-8469287 CAGAATGCAGAAAGTGGTGTTGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156975866 18:43220957-43220979 CAGAAAGCTGATAGAAATACAGG - Intergenic
1158706059 18:59793180-59793202 CAGAATGTCGATAGGTATATAGG + Intergenic
1159497904 18:69229767-69229789 CAGATTGCTGATATTGAGTTTGG - Intergenic
1164936117 19:32215329-32215351 CAGAATGTTGACATTGCTATAGG - Intergenic
1165293997 19:34911437-34911459 AAGAATGGTGATAGGGATAAGGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925323204 2:2993028-2993050 GAGAAAGCTAATAATGATATAGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926824915 2:16896381-16896403 TAGAATGATGATAGAGACATGGG - Intergenic
927010715 2:18900842-18900864 CAGACTGCTGGTGGTGATGTTGG + Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929900231 2:45994220-45994242 CAGAATGCTGATGGTGAGGGAGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931453512 2:62388359-62388381 CAGAATGCTGAGACTGAGGTGGG - Intergenic
932021713 2:68094367-68094389 CAGTATCCTGATAGTGACAGTGG + Intronic
932783689 2:74580792-74580814 CAGAATACTGGTAGTGGTAGTGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935733406 2:106085236-106085258 CAGAATTCTGATAATGGAATGGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938773063 2:134517338-134517360 CAGAAGGCTGATGGGGAGATGGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939677511 2:145090686-145090708 CAGAATGTTGATGGAAATATGGG + Intergenic
940065432 2:149622518-149622540 CAGGAAGCTCATAGTGCTATTGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941614735 2:167706544-167706566 CTCAATGGTGATAGTGAGATGGG + Intergenic
941797996 2:169622555-169622577 CAGATTGCTGAAACTGATAAGGG - Intronic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
945189228 2:207168620-207168642 CAGACGGCTGATAGTTACATAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946468973 2:219938951-219938973 CAGAATGCTCATAGAAACATGGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947738404 2:232472393-232472415 AAGTATACTGATAGTCATATGGG + Intergenic
1169576267 20:6965318-6965340 TAGATTGCTGAAAGAGATATTGG + Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171197245 20:23209412-23209434 CAGAATGTTGATATAAATATGGG + Intergenic
1172712343 20:36935544-36935566 CATAATACCTATAGTGATATGGG - Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1174755696 20:53156199-53156221 CCCATTGCTGATAGAGATATGGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1179578481 21:42322323-42322345 CAGAATTTTGATTGTCATATGGG - Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
950256347 3:11509904-11509926 CAGGATCCTGATAGTGATCTTGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
952775790 3:37044772-37044794 CAGTATGCTGTTAGCCATATAGG + Intronic
954955162 3:54512435-54512457 AAGAATGATGATAGTGACACCGG + Intronic
955066376 3:55536784-55536806 CAGCATTCTGAGAGTGATCTAGG - Intronic
958138129 3:89523341-89523363 CAGAATGCTGCAAGTAATTTGGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG + Intergenic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964928788 3:161989856-161989878 AGGAATGCTGCTAGTGACATAGG + Intergenic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966250712 3:177862204-177862226 AAGACTGCTGATAGTCATATTGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969367331 4:6704578-6704600 CAGAAAGCTGATAGTGTTTAGGG + Intergenic
969876666 4:10140507-10140529 CAGAATTCTGAAAGTGGTATAGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971546637 4:27894725-27894747 CAGAATGTTGGTAGATATATGGG - Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979740381 4:124142789-124142811 AAGCATGCTAATAGTGATATAGG + Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983695701 4:170527267-170527289 GATAATGCTGATAGTTTTATGGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984273910 4:177584175-177584197 CAGAATGGTGAGATTGACATAGG - Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985127555 4:186709993-186710015 AAGAATGTTGATACTTATATTGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987781382 5:22440762-22440784 TAGAACGCTTATAGTTATATTGG + Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
988990316 5:36663995-36664017 CAGAATGAGGATAGTGACCTTGG - Intronic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993937614 5:94023281-94023303 TATGGTGCTGATAGTGATATGGG - Intronic
993956606 5:94242320-94242342 AAGCATGCTGATAGTGGTAATGG - Intronic
994100261 5:95883738-95883760 CAGAAAGCTGACAGTGGTAGTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995135451 5:108675234-108675256 AAGAATGCTGACAGTGAAAGAGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996187358 5:120493592-120493614 CAGAATATTGACATTGATATAGG + Intronic
997117646 5:131142691-131142713 CAGAATGTTGATAGTGGTGGAGG + Intergenic
998997913 5:147886261-147886283 CAGTATGCTGACATTGATACAGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000948901 5:167456242-167456264 CAGAATGCTCAAAGTGGTTTGGG - Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007230446 6:40344295-40344317 CAGAATGCTGATTGACATATAGG - Intergenic
1007545298 6:42688888-42688910 AAGAATTTAGATAGTGATATAGG + Intronic
1008002245 6:46372801-46372823 CAGACTTCTGATAGTTAAATGGG - Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008952966 6:57181080-57181102 CAGAATGTTGGTAGGGATATGGG + Intronic
1008953573 6:57188669-57188691 CCCATTGCTGATAGTGACATAGG - Exonic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010102872 6:72130583-72130605 CAGCAAGATGATAGTGTTATTGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012771209 6:103437243-103437265 CAGAATGCTAATAGAGACATAGG - Intergenic
1013112925 6:107078806-107078828 TAGCATGCTGGTAGTGATATGGG + Intronic
1013863756 6:114668496-114668518 CAGAATGTTGATAGTGGGAGAGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1013984986 6:116180731-116180753 CAGAATGAGGAAAGTGCTATGGG + Intronic
1014483472 6:121968765-121968787 CATAATGCTGTTAGTGGCATAGG + Intergenic
1015121726 6:129707964-129707986 AAGAATGGTGATAGTGGTTTCGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016427417 6:143949269-143949291 CAGAAGGATGATAATGATTTGGG - Intronic
1016465415 6:144320378-144320400 CAGGCTGCTGATAGTGAGAGGGG + Intronic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020484716 7:8706895-8706917 CAGAATGGTGAGAGTGAGAAGGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1023456717 7:40347499-40347521 CTGAATGCTTATAGTAAAATGGG + Intronic
1024223334 7:47304762-47304784 CAGAATGCTGAGAGGCATGTGGG - Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1027337444 7:77167893-77167915 AAGAATTTTGATAATGATATTGG - Intronic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1028123205 7:87080905-87080927 CTGAATGGTGACAGTGACATAGG - Intergenic
1028676226 7:93465055-93465077 CTGAAAGCTGATAGAAATATAGG - Intronic
1029778298 7:102702905-102702927 AAGAATTTTGATAATGATATTGG + Intergenic
1029952433 7:104601509-104601531 CAGAATGATGAGACAGATATAGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1033410343 7:141111873-141111895 CAGAATGAAAATATTGATATAGG - Intronic
1033913548 7:146294792-146294814 CAGAATGTTGTCAGTCATATTGG + Intronic
1033975369 7:147094243-147094265 CAGAATGTTGATAGAAATTTGGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038384053 8:27124150-27124172 CAGAATGCTTTTAATGAGATGGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039083862 8:33760392-33760414 CTGAATGCTGGTAGTTCTATAGG + Intergenic
1040395226 8:46992423-46992445 CAGAATCCTGAGAGTTAAATTGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040977175 8:53206361-53206383 CAGGCTGCAGAGAGTGATATTGG + Intergenic
1041149407 8:54915709-54915731 CACAATGCTGACAGTTATTTTGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044906277 8:97007152-97007174 CAGAATGCTGTTAAAGATGTCGG - Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045977695 8:108148276-108148298 GAGAATGCTGACAGTGATTAAGG - Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046544212 8:115627779-115627801 AAGAAAGCTGTTAGTTATATTGG - Intronic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047915867 8:129583202-129583224 CAGACAGCTGTTAATGATATCGG - Intergenic
1048270983 8:133027749-133027771 CAGAATTCTAATTGTGAAATAGG + Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050802197 9:9629473-9629495 CAGGATGCTGATTGTAATTTGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052307048 9:27022366-27022388 AAGAATGATGATGGTGAAATGGG + Intronic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059889154 9:118781941-118781963 AAGAATGCTGACAGTGACATTGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186616505 X:11194003-11194025 TAGGATGATGATATTGATATTGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193357077 X:80533547-80533569 AAGAATGCTGCAAGTGAAATTGG + Intergenic
1193565805 X:83075696-83075718 TAGAATGCTGTTTGTGATACAGG + Intergenic
1193687500 X:84595605-84595627 CAGACTGCTGAGAGTGAGAGAGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199556943 X:149119843-149119865 CAGAAGTCTGAAAGTAATATAGG - Intergenic
1200677416 Y:6166302-6166324 CAGGATGTTGATAGTGAGAGAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic