ID: 974639343

View in Genome Browser
Species Human (GRCh38)
Location 4:64608740-64608762
Sequence CATCATATAGAGATATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 3, 2: 7, 3: 18, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974639337_974639343 28 Left 974639337 4:64608689-64608711 CCTGTAATGGTTTGAAGGATTAG 0: 1
1: 0
2: 2
3: 13
4: 85
Right 974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG 0: 1
1: 3
2: 7
3: 18
4: 169
974639340_974639343 -2 Left 974639340 4:64608719-64608741 CCGAGAAGTGAGCCAAGATTTCA 0: 1
1: 1
2: 13
3: 44
4: 328
Right 974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG 0: 1
1: 3
2: 7
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974639343 Original CRISPR CATCATATAGAGATATTGGA TGG Intergenic
901113856 1:6823579-6823601 CATCATATAGAAAGATTTTATGG - Intronic
904283600 1:29438754-29438776 CATCACATAAAGTTATTAGAGGG - Intergenic
905366754 1:37455875-37455897 CTTCATAAAGAGAATTTGGAGGG - Intergenic
906370823 1:45252074-45252096 TATCATATAGAGTTATTGCAAGG - Intronic
906491140 1:46269755-46269777 GATCATATTAATATATTGGAAGG - Intronic
909046896 1:70721168-70721190 TATCAACTAGAGATATGGGATGG + Intergenic
911416433 1:97580958-97580980 CATCAGATATTGATAATGGAGGG + Intronic
920745781 1:208626899-208626921 CATCATAGACAGATACAGGAGGG - Intergenic
923371015 1:233312601-233312623 CTTCATACAGAGAATTTGGAAGG - Intergenic
923613875 1:235520039-235520061 CATCATGCAGAAATATTTGATGG - Intergenic
1063979061 10:11439251-11439273 AAACATATAGAGACATAGGACGG + Intergenic
1064024450 10:11836004-11836026 CACCATATAGGGATTTTGGGGGG + Intronic
1068838070 10:61578013-61578035 AAACATAGAGAGATATGGGATGG + Intergenic
1069188225 10:65453814-65453836 GATCATAAAGAGAGATTGAATGG - Intergenic
1070118371 10:73551223-73551245 CATCATATGGAGACATTTGTAGG - Intronic
1071376972 10:85016009-85016031 CATTGGATAGAGATATTGGATGG + Intergenic
1072450465 10:95535569-95535591 CTGCATATAGAAATCTTGGAAGG + Intronic
1073911991 10:108356808-108356830 CATCATATCGAGATAATGCCTGG - Intergenic
1074336649 10:112583080-112583102 CATCTTATAGAGATAAAGAAAGG + Intronic
1076298733 10:129407516-129407538 CATCCTATGGAGATTTTGGACGG - Intergenic
1078445216 11:11399183-11399205 CATCATGTAAAGATATGAGAAGG + Intronic
1078875629 11:15392714-15392736 CATCACAGAGATATCTTGGATGG - Intergenic
1080301207 11:30786954-30786976 CATCATATAGAAATACTACAAGG - Intergenic
1080382899 11:31792540-31792562 CAACAATTAGAGATATTAGATGG - Intronic
1086533644 11:87816065-87816087 CATCATGTAGAGATGTTAGATGG + Intergenic
1086807259 11:91260010-91260032 CAACAAGAAGAGATATTGGAAGG + Intergenic
1088237669 11:107742573-107742595 TATCATTTAAAAATATTGGATGG - Intergenic
1092943831 12:13435148-13435170 TTACATATAGAGAGATTGGAAGG + Intergenic
1093829113 12:23733963-23733985 CTTCATAGAGAGATTTTTGAGGG - Intronic
1096192525 12:49629711-49629733 GATCAGATAGAGAAATAGGAAGG + Intronic
1098126253 12:67296740-67296762 AATCATTTAGAGATTTTGGAAGG + Intronic
1099186341 12:79519491-79519513 CATGGTATAGAGATGTTGTATGG - Intergenic
1100903649 12:99272925-99272947 CATGATCCAGAGATATTGGTAGG - Intronic
1104372884 12:128238746-128238768 CATCTTGTAGAGACTTTGGAGGG + Intergenic
1107281573 13:38742356-38742378 CCTCATATAGAGAAATTATATGG + Intronic
1108684279 13:52805241-52805263 CCTCATATAGAGATACTGACGGG - Intergenic
1110380133 13:74840907-74840929 CACCATATAGATATAATTGAAGG - Intergenic
1111455333 13:88475620-88475642 CATCACAAAGAGAAATTGCAGGG + Intergenic
1112056626 13:95694638-95694660 CATCATGTAGAGATGTTGGATGG - Intronic
1112816036 13:103274747-103274769 CATCATATAGGGTTATTGTGAGG - Intergenic
1115051948 14:29073362-29073384 CATCCTAGAGACATATTGAATGG - Intergenic
1115074934 14:29377052-29377074 CATGATTTTGAGATATTGAAAGG + Intergenic
1117367404 14:55042828-55042850 CATGAAAAAGAGATGTTGGAAGG - Intronic
1117516292 14:56505106-56505128 AATCCTATAGAGTTATTTGAAGG + Intronic
1117600972 14:57374116-57374138 AATCATATAAAGTTATTGTACGG + Intergenic
1118505852 14:66410917-66410939 CATCATATGCAAATATCGGAAGG - Intergenic
1120412640 14:84176486-84176508 CATCATATAGAAATATTCGATGG - Intergenic
1125093625 15:35825716-35825738 GATCATAGAGAGGCATTGGAGGG - Intergenic
1126970629 15:54108122-54108144 CAGCATTTAGAGATAATGGTTGG + Intronic
1127351272 15:58155029-58155051 CATCATGTAGAAATGTTGGATGG - Intronic
1131461907 15:92623424-92623446 CTTCCTATAGAGATTTTGGTGGG - Intronic
1131915225 15:97257882-97257904 CATAATATAGAAATGTTGGCAGG + Intergenic
1133992519 16:10719671-10719693 CATCATGTGGAAATGTTGGACGG + Intergenic
1137459267 16:48644630-48644652 TATTATAAAGAGATATTGGCCGG + Intergenic
1137552439 16:49448456-49448478 CATAATATATAGATATTAAAAGG - Intergenic
1141226551 16:82121678-82121700 CATCATGTAGAAATGTTAGAGGG + Intergenic
1144255941 17:13467179-13467201 CTTCATATATATATATAGGAAGG - Intergenic
1145399481 17:22519647-22519669 CATCATATGGAGATGTTGGATGG - Intergenic
1150095140 17:62367383-62367405 CATTATTTAGAGATCTTGCAGGG - Intergenic
1153410195 18:4783767-4783789 CAGCAGATAGAGATATTGCAGGG - Intergenic
1156411630 18:36834053-36834075 CATCTTATAAAAATCTTGGAAGG - Intronic
1157407201 18:47432017-47432039 CATCATATCTAGGTACTGGAAGG - Intergenic
1164127050 19:22327931-22327953 TATCATATAAAGATCTTGGGTGG + Intergenic
926543971 2:14215835-14215857 CTTCATAAAGAGATATAGAAAGG + Intergenic
933478090 2:82818200-82818222 CATCATGTAGAAATGTTAGATGG - Intergenic
934013036 2:87845231-87845253 TATCTTATAGAGTTATTGTAAGG + Intergenic
934172358 2:89551597-89551619 CAGCAAAGAGAGACATTGGAAGG - Intergenic
934282671 2:91625949-91625971 CAGCAAAGAGAGACATTGGAAGG - Intergenic
938309886 2:130282749-130282771 CATCATATAGAGATATGAGATGG - Intergenic
938445031 2:131369620-131369642 CATCATATAGAGATATGAGATGG + Intergenic
938986090 2:136578055-136578077 TATCTTATAGAGATTGTGGAGGG + Intergenic
940204661 2:151189693-151189715 CATCATATAGAAATAGTTGGGGG - Intergenic
940562327 2:155314102-155314124 CATCATGTAGTAATATTAGATGG - Intergenic
940607465 2:155944877-155944899 AATCATATGGTGATATTAGAAGG + Intergenic
940973268 2:159916944-159916966 CATATTCTAGAGCTATTGGAAGG + Intergenic
942701407 2:178715216-178715238 CATCCTATAGAGACACTGAAAGG - Exonic
943983688 2:194591198-194591220 GATAAAATAGAAATATTGGATGG - Intergenic
944298846 2:198099269-198099291 TATCATTTAGAGATCTTGGAAGG + Intronic
947561361 2:231155974-231155996 CATAATATAAAAATATTGGAAGG - Intronic
1170472483 20:16682195-16682217 CAACATAGAGAGATATTAGCTGG - Intergenic
1171264602 20:23760493-23760515 CAACATCTAGGGAAATTGGAGGG + Intergenic
1175697102 20:61110884-61110906 CATCATATTGAGCGATTGGCAGG - Intergenic
1177046970 21:16182995-16183017 CATTTTATAAAGATAATGGAGGG - Intergenic
1179029522 21:37708450-37708472 AATGAGATAGACATATTGGAAGG + Intronic
1179915139 21:44472419-44472441 CATCATGCAGAGATAGTTGATGG + Intergenic
1180754473 22:18151134-18151156 ATTCATATTGAGAAATTGGAAGG + Intronic
1181841096 22:25662234-25662256 CCTAATATAGAGATATTACATGG - Intronic
1182110876 22:27722452-27722474 CATCATATATGAATTTTGGAGGG - Intergenic
951475917 3:23106177-23106199 AAATATATAGAGATAGTGGAGGG + Intergenic
951490233 3:23262155-23262177 AACCATAAAGAGATACTGGATGG - Intronic
955624870 3:60907858-60907880 AATCACATAGAGTTATTGCAAGG - Intronic
955981384 3:64530943-64530965 CATAATGTATAGATTTTGGAGGG + Intronic
956175339 3:66467795-66467817 CATGATATAGATATATTCGTTGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957651238 3:83007957-83007979 CATCATATGGAGTTATTTGTGGG - Intergenic
959372507 3:105545735-105545757 CTTCATATAAAGAAATTGAAGGG + Intronic
959844418 3:111016856-111016878 AATTATATAAATATATTGGAAGG - Intergenic
960689141 3:120325730-120325752 CATCTTATGAAGATATTGTAAGG - Exonic
961117813 3:124346791-124346813 AATCACATAAAGATATTGGCAGG - Intronic
961140678 3:124553215-124553237 TGCCATATAGAGTTATTGGAAGG - Intronic
962638053 3:137351147-137351169 CATCAGATAGAAAAGTTGGACGG - Intergenic
963115714 3:141727419-141727441 CATCATATAGAGATAGTGTTTGG + Intergenic
963821507 3:149899893-149899915 AATCAAATGGAGATATTGAATGG + Intronic
969027386 4:4184259-4184281 CAGCAAATAGCGACATTGGAAGG + Intergenic
970113257 4:12662771-12662793 CATCAAATAGAGAAAGAGGAAGG + Intergenic
970963508 4:21900761-21900783 CATCAAATAGAAATATGGCAGGG - Intronic
974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG + Intergenic
975049014 4:69836376-69836398 CATCTTATAGAGACATTCTAAGG + Intronic
977448177 4:97158584-97158606 CATCATATAGAAATGTTAGATGG - Intergenic
980801254 4:137753333-137753355 CATCATACACAGTGATTGGAAGG + Intergenic
981436586 4:144730824-144730846 CATTACAAAGAGTTATTGGAGGG + Intronic
983299312 4:165904870-165904892 CATCAAAAAGAGAAATTGGACGG + Intronic
983384026 4:167035286-167035308 AATCATATAGAAATAATGGAAGG - Intronic
983714940 4:170770034-170770056 AATCAGATAGAGATATTCTACGG - Intergenic
984450840 4:179899136-179899158 CAACACATAGATATATTGTAAGG - Intergenic
986521100 5:8619247-8619269 CATCATATAGAAATGTTAAATGG - Intergenic
986858320 5:11898185-11898207 CAGCATGTTGGGATATTGGAAGG - Intronic
992381917 5:76246000-76246022 CAGCATATAGAGATTATGGTTGG + Intronic
993961782 5:94306673-94306695 GAAAATATAGAGATATTAGAGGG + Intronic
993983447 5:94569609-94569631 CATCATGTGGAGATGTTAGATGG - Intronic
994458494 5:100046283-100046305 CATCATGTGGAGATATTGGATGG + Intergenic
994767949 5:103944412-103944434 TATAATATAGATATATTTGATGG - Intergenic
995353218 5:111206373-111206395 CATCATAGACAGATATTGTTAGG + Intergenic
997570536 5:134923958-134923980 CATCATGCGGAGATATTGGATGG + Intronic
1000658737 5:163914040-163914062 TATCCTACAGAGATAATGGATGG + Intergenic
1002628034 5:180546538-180546560 CATCACAAAGAAATAATGGATGG - Intronic
1002820707 6:721835-721857 TATCATATAGTGATATTAGGAGG - Intergenic
1004144159 6:13048895-13048917 CATCAGATAATGATATTGGAAGG - Intronic
1004342612 6:14820692-14820714 CAGCATACACAGATATTGGCAGG - Intergenic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1007142062 6:39585999-39586021 CCTCATACACAGATTTTGGAAGG - Intronic
1007648644 6:43402365-43402387 CATCATTTATAGATATAAGAGGG - Intergenic
1008458287 6:51737876-51737898 CATCATAAAAAAATATTGGCAGG + Intronic
1008834018 6:55804392-55804414 CATCCTCTAGAGGTTTTGGAGGG + Intronic
1011908259 6:92401497-92401519 CATCATGTAATGATATTTGATGG + Intergenic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1013285492 6:108677654-108677676 GATCACATAGTGATGTTGGATGG + Intronic
1014923354 6:127239632-127239654 CATCAGATAGAATTATTGAAAGG - Intergenic
1017246145 6:152227647-152227669 CATATTAAAGACATATTGGAAGG - Intronic
1021953768 7:25802968-25802990 CCTCCTAAAAAGATATTGGAAGG + Intergenic
1021975827 7:26010207-26010229 CATCACAAAGGGCTATTGGAAGG + Intergenic
1022982339 7:35616139-35616161 CATCAATTAGAAATATTGCATGG + Intergenic
1025226899 7:57173428-57173450 CATCATATAGAGATATTAGATGG - Intergenic
1025229966 7:57196709-57196731 CATCATATAGAGATATTAGATGG - Intergenic
1026292949 7:69025212-69025234 TTTCAGAAAGAGATATTGGAGGG - Intergenic
1026760231 7:73121186-73121208 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1027036573 7:74930007-74930029 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1027086988 7:75271455-75271477 CACCCTATAGAGTTGTTGGAAGG + Intergenic
1027488261 7:78788799-78788821 CATCATATAAAGATGTTTCAAGG - Intronic
1027671610 7:81106321-81106343 CATCTTACATAGATATAGGAAGG - Intergenic
1028901714 7:96108396-96108418 AATCATATAAAGACATTGCAAGG - Intronic
1029716142 7:102327569-102327591 TAGGATATAGAGATATAGGAAGG - Intergenic
1031030775 7:116732261-116732283 CATCATTGAGAAATATTGGCAGG + Intronic
1033827390 7:145208144-145208166 CAGCATACAGAGAGATTGGCTGG + Intergenic
1034366775 7:150556879-150556901 AAGCATATAGAGACATTGCATGG - Intergenic
1035755803 8:2031834-2031856 CCACATATAGAAATATTGAATGG + Intergenic
1037434597 8:18849285-18849307 CATCATATAGAAATGATAGATGG - Intronic
1038481279 8:27903404-27903426 CATCATATAGAAATGTTAGATGG + Intronic
1039307524 8:36278795-36278817 CGTCATATAGAAATATTGGATGG + Intergenic
1039313964 8:36351575-36351597 CATCACATAGTGATAGTGGGAGG + Intergenic
1040393421 8:46970674-46970696 CATTTTATAGAAATATTGGCCGG + Intergenic
1042331213 8:67582613-67582635 CATCATGTAGAAATTTTAGATGG + Intronic
1042447217 8:68899364-68899386 CATCATCTAGTGATGTGGGATGG + Intergenic
1042650910 8:71040111-71040133 CATCATATAGACATACTTCAGGG - Intergenic
1043070842 8:75634025-75634047 CATCATATATATATATATGATGG - Intergenic
1043668638 8:82851650-82851672 CATTATATTGAGTTTTTGGAAGG + Intergenic
1043844243 8:85146128-85146150 CTTCATATACAGTTATTAGAAGG - Intergenic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1044485687 8:92750918-92750940 CAAAATATAGATATCTTGGAAGG + Intergenic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045653592 8:104365452-104365474 CACCATATACAGAGATGGGAGGG + Intronic
1046032096 8:108794879-108794901 CATCATATAGAGATAGAAGATGG - Intergenic
1046647516 8:116802222-116802244 TAGGATATGGAGATATTGGAGGG + Intronic
1047124266 8:121943192-121943214 CATTATTTAGAGATAGTGAAGGG + Intergenic
1050781052 9:9336515-9336537 TATCATTTAGGGATATGGGAAGG - Intronic
1051042242 9:12825609-12825631 CATCAAATAGAGATGCTGCAGGG - Intergenic
1051502134 9:17789392-17789414 CATCATCTAAAGAAGTTGGAGGG + Exonic
1052374447 9:27702378-27702400 CATCTTATAGAGGTCTTTGAAGG - Intergenic
1053949187 9:43349934-43349956 CATCATCTAATGATATTGAATGG - Intergenic
1058068249 9:100573634-100573656 TATCAAATACAGATATTGGCAGG + Intronic
1058823151 9:108751259-108751281 GATCATTCAGAGATATTTGAAGG - Intergenic
1202630805 M:14816-14838 CATCATGCGGAGATGTTGGATGG - Intergenic
1186013963 X:5169581-5169603 CATCATATAGAGATATTAGATGG - Intergenic
1187068416 X:15863822-15863844 CTTTATATAAGGATATTGGAGGG + Intergenic
1187957181 X:24530767-24530789 CTTGACATAGAGATATAGGAGGG + Intronic
1190045323 X:47107260-47107282 AATCATATTGAGATATTGAGAGG + Intergenic
1190930286 X:54943181-54943203 TATCATCTAGACATATTAGAGGG + Intronic
1192730493 X:73798473-73798495 CATTATATAGAAAAATTAGAGGG + Intergenic
1192880670 X:75280033-75280055 CATCATATATATATATTTGTTGG + Intronic
1194222544 X:91213607-91213629 CTTCATATAGAGACAGAGGAAGG + Intergenic
1194241846 X:91458906-91458928 CATAATATATAGATATTACATGG - Intergenic
1195355643 X:104037431-104037453 CACCATAAAGAGTTATTGGGAGG + Intergenic
1196067492 X:111481105-111481127 CACCATATAGAAATATGTGAGGG + Intergenic
1197459975 X:126729173-126729195 CATCATATAGAAATGTTAGATGG - Intergenic
1198511529 X:137356652-137356674 AATCTTATAGAGAAATTAGAAGG - Intergenic
1199131437 X:144193250-144193272 TATCTTATAGAGTTATTGTAAGG - Intergenic
1199435878 X:147812072-147812094 CATCATATTGAGAACTTAGAAGG - Intergenic
1200894826 Y:8364099-8364121 CATCATGTAGAAATGTTAGATGG - Intergenic