ID: 974641562

View in Genome Browser
Species Human (GRCh38)
Location 4:64639456-64639478
Sequence CTGTTTTCCATTAAGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974641560_974641562 1 Left 974641560 4:64639432-64639454 CCAGCATATGTACAGTTTTAAAT No data
Right 974641562 4:64639456-64639478 CTGTTTTCCATTAAGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974641562 Original CRISPR CTGTTTTCCATTAAGAAAAA GGG Intergenic
No off target data available for this crispr