ID: 974644619

View in Genome Browser
Species Human (GRCh38)
Location 4:64674794-64674816
Sequence AATTATCTGCAGGAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974644614_974644619 16 Left 974644614 4:64674755-64674777 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG No data
974644615_974644619 15 Left 974644615 4:64674756-64674778 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG No data
974644613_974644619 22 Left 974644613 4:64674749-64674771 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG No data
974644616_974644619 4 Left 974644616 4:64674767-64674789 CCAAGAGCTGTCTCTCAAAAGAA 0: 15
1: 201
2: 219
3: 189
4: 415
Right 974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974644619 Original CRISPR AATTATCTGCAGGAAATGGC AGG Intergenic
No off target data available for this crispr