ID: 974646417

View in Genome Browser
Species Human (GRCh38)
Location 4:64699123-64699145
Sequence CTGGATCTACCAGGATTTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974646417_974646421 4 Left 974646417 4:64699123-64699145 CCGTAAAATCCTGGTAGATCCAG No data
Right 974646421 4:64699150-64699172 TAAGCTAATATAATCATCTAGGG No data
974646417_974646420 3 Left 974646417 4:64699123-64699145 CCGTAAAATCCTGGTAGATCCAG No data
Right 974646420 4:64699149-64699171 CTAAGCTAATATAATCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974646417 Original CRISPR CTGGATCTACCAGGATTTTA CGG (reversed) Intergenic
No off target data available for this crispr