ID: 974649359

View in Genome Browser
Species Human (GRCh38)
Location 4:64734218-64734240
Sequence TTTGTTAGGTCCTTTGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974649354_974649359 10 Left 974649354 4:64734185-64734207 CCAGAAGGCCTTTACTATTCTAA No data
Right 974649359 4:64734218-64734240 TTTGTTAGGTCCTTTGTCCATGG No data
974649357_974649359 2 Left 974649357 4:64734193-64734215 CCTTTACTATTCTAAATGGGCAT No data
Right 974649359 4:64734218-64734240 TTTGTTAGGTCCTTTGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974649359 Original CRISPR TTTGTTAGGTCCTTTGTCCA TGG Intergenic
No off target data available for this crispr