ID: 974656890

View in Genome Browser
Species Human (GRCh38)
Location 4:64836858-64836880
Sequence AAGGGTCGCTTGAACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974656890_974656894 -7 Left 974656890 4:64836858-64836880 CCTCCCGAGTTCAAGCGACCCTT No data
Right 974656894 4:64836874-64836896 GACCCTTGCCTTAGCCTTCCGGG No data
974656890_974656893 -8 Left 974656890 4:64836858-64836880 CCTCCCGAGTTCAAGCGACCCTT No data
Right 974656893 4:64836873-64836895 CGACCCTTGCCTTAGCCTTCCGG No data
974656890_974656897 -3 Left 974656890 4:64836858-64836880 CCTCCCGAGTTCAAGCGACCCTT No data
Right 974656897 4:64836878-64836900 CTTGCCTTAGCCTTCCGGGTAGG No data
974656890_974656900 9 Left 974656890 4:64836858-64836880 CCTCCCGAGTTCAAGCGACCCTT No data
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974656890 Original CRISPR AAGGGTCGCTTGAACTCGGG AGG (reversed) Intergenic
No off target data available for this crispr