ID: 974656897

View in Genome Browser
Species Human (GRCh38)
Location 4:64836878-64836900
Sequence CTTGCCTTAGCCTTCCGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974656889_974656897 0 Left 974656889 4:64836855-64836877 CCGCCTCCCGAGTTCAAGCGACC No data
Right 974656897 4:64836878-64836900 CTTGCCTTAGCCTTCCGGGTAGG No data
974656890_974656897 -3 Left 974656890 4:64836858-64836880 CCTCCCGAGTTCAAGCGACCCTT No data
Right 974656897 4:64836878-64836900 CTTGCCTTAGCCTTCCGGGTAGG No data
974656888_974656897 3 Left 974656888 4:64836852-64836874 CCTCCGCCTCCCGAGTTCAAGCG 0: 419
1: 9339
2: 50555
3: 129980
4: 168095
Right 974656897 4:64836878-64836900 CTTGCCTTAGCCTTCCGGGTAGG No data
974656891_974656897 -6 Left 974656891 4:64836861-64836883 CCCGAGTTCAAGCGACCCTTGCC No data
Right 974656897 4:64836878-64836900 CTTGCCTTAGCCTTCCGGGTAGG No data
974656892_974656897 -7 Left 974656892 4:64836862-64836884 CCGAGTTCAAGCGACCCTTGCCT No data
Right 974656897 4:64836878-64836900 CTTGCCTTAGCCTTCCGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974656897 Original CRISPR CTTGCCTTAGCCTTCCGGGT AGG Intergenic
No off target data available for this crispr