ID: 974656900

View in Genome Browser
Species Human (GRCh38)
Location 4:64836890-64836912
Sequence TTCCGGGTAGGTGAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974656888_974656900 15 Left 974656888 4:64836852-64836874 CCTCCGCCTCCCGAGTTCAAGCG 0: 419
1: 9339
2: 50555
3: 129980
4: 168095
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data
974656890_974656900 9 Left 974656890 4:64836858-64836880 CCTCCCGAGTTCAAGCGACCCTT No data
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data
974656896_974656900 -10 Left 974656896 4:64836877-64836899 CCTTGCCTTAGCCTTCCGGGTAG No data
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data
974656892_974656900 5 Left 974656892 4:64836862-64836884 CCGAGTTCAAGCGACCCTTGCCT No data
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data
974656889_974656900 12 Left 974656889 4:64836855-64836877 CCGCCTCCCGAGTTCAAGCGACC No data
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data
974656891_974656900 6 Left 974656891 4:64836861-64836883 CCCGAGTTCAAGCGACCCTTGCC No data
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data
974656895_974656900 -9 Left 974656895 4:64836876-64836898 CCCTTGCCTTAGCCTTCCGGGTA No data
Right 974656900 4:64836890-64836912 TTCCGGGTAGGTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974656900 Original CRISPR TTCCGGGTAGGTGAGATTAC AGG Intergenic
No off target data available for this crispr