ID: 974660973

View in Genome Browser
Species Human (GRCh38)
Location 4:64888406-64888428
Sequence CAGTGGGACTGGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974660966_974660973 6 Left 974660966 4:64888377-64888399 CCTTTTGGGCTTGAGTTTCATCA No data
Right 974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG No data
974660963_974660973 12 Left 974660963 4:64888371-64888393 CCCTGCCCTTTTGGGCTTGAGTT No data
Right 974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG No data
974660965_974660973 7 Left 974660965 4:64888376-64888398 CCCTTTTGGGCTTGAGTTTCATC No data
Right 974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG No data
974660964_974660973 11 Left 974660964 4:64888372-64888394 CCTGCCCTTTTGGGCTTGAGTTT No data
Right 974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG No data
974660960_974660973 22 Left 974660960 4:64888361-64888383 CCTGGGGCAACCCTGCCCTTTTG No data
Right 974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974660973 Original CRISPR CAGTGGGACTGGAGGCAGGA GGG Intergenic
No off target data available for this crispr