ID: 974667768

View in Genome Browser
Species Human (GRCh38)
Location 4:64987257-64987279
Sequence TTCGTGCTGTAAAATTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974667768_974667769 4 Left 974667768 4:64987257-64987279 CCATGTAAATTTTACAGCACGAA No data
Right 974667769 4:64987284-64987306 AAAGCAAATACATCCTGTGAAGG No data
974667768_974667770 8 Left 974667768 4:64987257-64987279 CCATGTAAATTTTACAGCACGAA No data
Right 974667770 4:64987288-64987310 CAAATACATCCTGTGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974667768 Original CRISPR TTCGTGCTGTAAAATTTACA TGG (reversed) Intergenic
No off target data available for this crispr