ID: 974667770

View in Genome Browser
Species Human (GRCh38)
Location 4:64987288-64987310
Sequence CAAATACATCCTGTGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974667767_974667770 9 Left 974667767 4:64987256-64987278 CCCATGTAAATTTTACAGCACGA No data
Right 974667770 4:64987288-64987310 CAAATACATCCTGTGAAGGTAGG No data
974667768_974667770 8 Left 974667768 4:64987257-64987279 CCATGTAAATTTTACAGCACGAA No data
Right 974667770 4:64987288-64987310 CAAATACATCCTGTGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974667770 Original CRISPR CAAATACATCCTGTGAAGGT AGG Intergenic
No off target data available for this crispr