ID: 974670492

View in Genome Browser
Species Human (GRCh38)
Location 4:65024041-65024063
Sequence GATGATTTACTAAGTAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974670492_974670498 22 Left 974670492 4:65024041-65024063 CCTGTCTTACTTAGTAAATCATC No data
Right 974670498 4:65024086-65024108 CAGCCAAGAACATAGCTGCCGGG No data
974670492_974670494 -1 Left 974670492 4:65024041-65024063 CCTGTCTTACTTAGTAAATCATC No data
Right 974670494 4:65024063-65024085 CCTAACACTCCCAATCTCTCAGG No data
974670492_974670497 21 Left 974670492 4:65024041-65024063 CCTGTCTTACTTAGTAAATCATC No data
Right 974670497 4:65024085-65024107 GCAGCCAAGAACATAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974670492 Original CRISPR GATGATTTACTAAGTAAGAC AGG (reversed) Intergenic
No off target data available for this crispr